                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:134 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-15.30 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCTTGTTGGTGTATCTGGAAGACTTCAAGTTAGAACTTATCAAGATGTTGATGGCAA
TAGAAAGTATATCACTGAAGTTGTTGGTGAAGAGGTTCAATTTTTAGAAACTAAAAAA
GAAGCGGTTTAAgaagacaccccaaaataatatgattttggggtgatttttaataattaatattaaaaagttaaaaaatttgcatttaaag
ttaaggttatgtaaaaaaatagaaaattcattgaaagtgtatgggatatattgatacaattacattaaaaatacataaaggggaggaaataaaATG

    CAC0946 Gene: CAC0946     GI: 15894233     BI number: CAC0946     GOG: COG2333     Description: ComE-like protein, Metallo beta-lactamase superfamily hydrolase, secrete            AA   T       A  A G  T      A  G A  G      A  A AT        TA GT        CG TG       |  C CG       A  G AT       A  G CG        AT TA        GT        ta A  A       AT       a  t T  G       TA       a  g A  A       TA        ta T  G       Tg        at G  G       Ta        at A  |       Ta        at AT       A  g       at AT       A  a       cg GC       C  c       cg A  A      T  |       cg TA        Ta        cg AT        Gc        at AT        Gc        cg                         atttttaataattaatattaaaaagttaaaaaatttgcatttaaagttaaggttatgtaaaaaaatagaaaattcattgaaagtgtatgggatatattgatacaattacattaaaaatacataaaggggaggaaataaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2333 Predicted hydrolase (metallo-beta-lactamase superfamily) ... can be seen here     ..................................................................................................................