                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:90 nt.    Distance to gene:130 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-12.60 kcal/mol
Antiterminator:    Distance from promoter:63 nt. Size=42 nt.     Delta G= -4.30 kcal/mol
Anti-antiterminator:    Distance from promoter:25 nt.    Size=58 nt.     Delta G= -5.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTATT-GAGAAT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTATTATATCAAGGTATTTGAAGAGAATACAATTAGTGTGTAAATATGCTGACTATA
TAGGAGGAATTATATTAGTTATATTTGGATTAAAGATGATGTTTTTTTAAtataagattaaga
tatgcctctcattttatagggggcatatttttttgcttgaaattgtaaaaaggcattatttaagttttacattgttttccgtatggtaaagaattgtgat
ataattagtatgaagaatacaatatatttttgtatatttttaataagataccaaggtgagattATG

    CAC0951 Gene: CAC0951     GI: 15894238     BI number: CAC0951     GOG: COG0735     Description: Ferric uptake regulation protei   T A  T T  T A  G TG TA GT AT TA         a TA       t  a |  A      a  g A  G       ta TA        At AT        At TG        Ta TA        Ta         t AT        Tg       t  t |  G       Ta       t  a AT       |  t      a  t GT       T  a      c  a GT       T  t       tg AT        Tg        cg GT        Gc        tg GT       |  c       cg AT       |  t       cg |  A      T  c       gc TA        At        ta At        Gc        at Ta        Ta        ta At        At        at Ta        Gt        gt                         tttttgcttgaaattgtaaaaaggcattatttaagttttacattgttttccgtatggtaaagaattgtgatataattagtatgaagaatacaatatatttttgtatatttttaataagataccaaggtgagattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0735 Fe2+/Zn2+ uptake regulation proteins ... can be seen here     ..................................................................................................................