Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:76 nt.    Distance to gene:129 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -9.50 kcal/mol
Antiterminator:    Distance from promoter:42 nt. Size=66 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:    Distance from promoter:13 nt.    Size=55 nt.     Delta G= -5.22 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TGGGTA-TATAAT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGGTATTAAAAACTCCAGAAGTCATATAATAATCAGCAGCATAGGTTATATCATGTA
GCTTGTTCAAATTAATTCTATGATCTATATAAAATATAATTAAAATGACTAAGAAAGC
CGCAATGAGTGGTTTCTTATTTTTGAAAATAAAATTTTTAAGCATagatgcacctctaataattgta
aaatatttacaaaaataattatattgctaaaatatataaaaaacaatacttatatataaaaatatttaaggaaggattaattgatATG

    CAC0953 --- CAC0954


Gene: CAC0953     GI: 15894240     BI number: CAC0953     GOG: NOG13547     Description: Hypothetical protein
Gene: CAC0954     GI: 15894241     BI number: CAC0954     GOG: COG0705     Description: Uncharacterized membrane protei


           TG
          A  A
          A  C
          A  T
          A  A
          T  A
  T        TG
T  A       AA
A  A       AA
A  T      T  A
A  T       AG
C  C       TC
T  T       AC
 TA        AG
 GT        AC
 TG        AA
 TA       T  A
C  T      A  T
 GC        TG
 AT        A
 TA        T         T
 GT       |        A  G
 TA       |        A  A
 AT       |         CG
|  A      |         GT
|  A      C         CG
C  A      T         CG
 TA        A       G  |
 AT        G        AT
 TA        T        AT
 AT        A        AT
 TA       T         GC
 TA       C         AT
 GT        T        AT
 GT        T        TA
                        TTTTTGAAAATAAAATTTTTAAGCATagatgcacctctaataattgtaaaatatttacaaaaataattatattgctaaaatatataaaaaacaatacttatatataaaaatatttaaggaaggattaattgatATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG0705 Uncharacterized membrane protein (homolog of Drosophila rhomboid) ... can be seen here

    ..................................................................................................................