                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:93 nt.    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-14.40 kcal/mol
Antiterminator:    Distance from promoter:41 nt. Size=59 nt.     Delta G= -3.62 kcal/mol
Anti-antiterminator:    Distance from promoter:7 nt.    Size=42 nt.     Delta G= -6.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TTATAT. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAACTCATATAGCTAAAATGTTTATATCAGGAGAGATTTCAGAGGGTGACATCTT
GAAAATAGAGGGCTCTGATTCGAAGCTTACAATAGTAAAAAAATAAatttattttaagaaatgaca
aatagaaggtaaggattatattaccttctattttttttttctaaaaagcaatactaaaaaggaaaacaatatatatggagatgttaataaATG

    CAC0960 Gene: CAC0960     GI: 15894247     BI number: CAC0960     GOG: COG0726     Description: Predicted xylanase related protei             A           A  A           A  T           A  A           A  A           A  a           T  t   A        Gt A  A       At G  A       Ta T  T       At TA        At CG       C  t TA        At A  G       Ta        tt C  G       Ta       a  a A  G       Cg       g  t G  |      G  a      g  a T  |      A  a       at G  |      A  a       at G  |       Gt        ta GC        Cg        gc AT        Ta        gc GC       |  c       at AT       |  a       at CG       T  a       gc TA       A  a       at T  T       Gt        ta T  |       Ta        at AT        Cg        at GC        Ta        at                         tttttttctaaaaagcaatactaaaaaggaaaacaatatatatggagatgttaataaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0726 Predicted xylanase/chitin deacetylase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_acetobutylicum                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:97 nt.    Distance to gene:57 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-10.20 kcal/mol Antiterminator:    Distance from promoter:60 nt. Size=59 nt.     Delta G= -3.62 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGAAA-TTATAT. It has a score value of 61.58 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGAAACTCATATAGCTAAAATGTTTATATCAGGAGAGATTTCAGAGGGTGACATCTT GAAAATAGAGGGCTCTGATTCGAAGCTTACAATAGTAAAAAAATAAatttattttaagaaatgaca aatagaaggtaaggattatattaccttctattttttttttctaaaaagcaatactaaaaaggaaaacaatatatatggagatgttaataaATG     CAC0960 Gene: CAC0960     GI: 15894247     BI number: CAC0960     GOG: COG0726     Description: Predicted xylanase related protei   a a  t a  g g  a a  c a  a t  a ta tt ta ag ta t  a tg ag At Aa T  a A  g       tt A  g      a  a Aa       g  t At       g  a A        at |         at |         ta A         gc A         gc T        at G        at A        gc T        at             attttttttttctaaaaagcaatactaaaaaggaaaacaatatatatggagatgttaataaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0726 Predicted xylanase/chitin deacetylase ... can be seen here     ..................................................................................................................