Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:134 nt.    Distance to gene:33 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G= -9.30 kcal/mol
Antiterminator:    Distance from promoter:79 nt. Size=63 nt.     Delta G= -3.09 kcal/mol
Anti-antiterminator:    Distance from promoter:61 nt.    Size=40 nt.     Delta G= -3.51 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTAATA-TATATT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAATATCATATACAGATGTGTGTTCTATATTTATGAAATTTCCAATGTATTTAGCTC
CTAGCTATTGGCTTGTACTTATGTTTACATTTACCAGCATATTTGTATCAGCAAGATC
AATAGTTAAGTATTGCTTTCATTAAaaaaaaaaggtatgattatttataagaaactctaattaaatttagagttttcttttc
tagttagaaagctttattgaaaggaacttaataATG

    CAC0967


Gene: CAC0967     GI: 15894254     BI number: CAC0967     GOG: NOG29752     Description: Probably membrane protei


           Aa
          A  a
          T  a
          T  a
          A  a
          C  a
           Ta
           Ta
           Tg
           Cg
           Gt
           Ta
  G       |  t
A  A      |  g
A  T      |  a
C  C      T  t
G  A       At
A  A       Ta
C  T       Gt
T  A       At
A  G       At        aa
T  T       Ta       t  a
 GT       T  t      t  t
 TA       G  a       at
 TA       A  a       at
 TG       T  g       ta
 AT       A  a       cg
 TA       A  a       ta
|  T      C  a       cg
 AT       T  c       at
 CG        At        at
 GC        Gc        at
 AT        At        gt
                        cttttctagttagaaagctttattgaaaggaacttaataATG


    ..................................................................................................................