                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:149 nt.    Distance to gene:24 nt.     Distance to run of Ts=2 nt.   Size=26 nt.     Delta G=-17.60 kcal/mol
Antiterminator:    Distance from promoter:114 nt. Size=40 nt.     Delta G= -6.90 kcal/mol
Anti-antiterminator:    Distance from promoter:100 nt.    Size=31 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tataat. It has a score value of 93.04 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacatttaaatatatactaactataatattaaataaagaaattaataaattagtgcacttatcaagagaggtggagggaccggccctgtgaagcccag
caacctgtatatgttaattatacaaggtgctaattcctgcagcgctagctgagagatgagaatataaatcgagcttttagagccagagtttattctctgg
ctcttattattttttaatctaatgggaaaaggtgaatgacATG

    CAC0984 --- CAC0985 --- CAC0986 Gene: CAC0984     GI: 15894271     BI number: CAC0984     GOG: COG1135     Description: ABC transporter, ATP-binding protein Gene: CAC0985     GI: 15894272     BI number: CAC0985     GOG: COG2011     Description: ABC transporter, permease component Gene: CAC0986     GI: 15894273     BI number: CAC0986     GOG: COG1464     Description: Lipoprotein, attached to the cytoplasmic membrane, NLPA famil             t           a  a           t  a           a  a            at            gc ct       a  g g  a      g  a cg       t  g gc       a  |       ta at        gc       t  t cg        at       t  t g  |       gt        gc ta        at        at cg        gt        gc c  a       ta        at t  g       cg        cg ta       g  |       cg at       a  |       gc a  g       ta        at ta        cg        gc cg        gc        at                         tattattttttaatctaatgggaaaaggtgaatgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1135 ABC-type metal ion transport system, ATPase component ... can be seen here [P] COG2011 ABC-type metal ion transport system, permease component ... can be seen here [P] COG1464 ABC-type metal ion transport system, periplasmic component/surface antigen ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................