                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:67 nt.    Distance to gene:130 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-10.00 kcal/mol
Antiterminator:    Distance from promoter:35 nt. Size=38 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ATGAAG-TAAAGT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGAAGTAATAGAGGTTTTGTTTCCTAAAGTCAGTAAGTTTGCCTTTAAGGGAAGTAA
GGCTACTAGTGTTTAAttatatagctaataatgtttaattagatgcctataagttataaggcatctttctttatatagatatgtatat
attacacaaacaattgtattttgttctaaaacatgttaagataattataatattagaggaaacctatgtcagtgtatattttgctttttatcaaatttta
ggagggctatagATG

    CAC0998 --- thrC Gene: CAC0998     GI: 15894285     BI number: CAC0998     GOG: COG0460     Description: Homoserine dehydrogenase Gene: thrC     GI: 15894286     BI number: CAC0999     GOG: COG0498     Description: Threonine synthas GG G  A       aa A  A      t  t A  G      c  a T  T      g  a TA        at TA        tg CG        at        gt CG       t  t      a  t GC        at       a  a T  T       ta       t  t T  |       ta       a  a TA        At        ta GC        At        cg A  |       Ta        cg AT        Tg        gc TA        Ta        ta G  G       Gt        at AT        Tg        gc CG        Gc        at                         ttctttatatagatatgtatatattacacaaacaattgtattttgttctaaaacatgttaagataattataatattagaggaaacctatgtcagtgtatattttgctttttatcaaattttaggagggctatagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0460 Homoserine dehydrogenase ... can be seen here [E] COG0498 Threonine synthase ... can be seen here     ..................................................................................................................