                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:48 nt.    Distance to gene:57 nt.     Distance to run of Ts=3 nt.   Size=28 nt.     Delta G=-10.40 kcal/mol
Antiterminator:    Distance from promoter:15 nt. Size=45 nt.     Delta G= -4.22 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaat-tataat. It has a score value of 89.02 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaataattttggtcattattatataattttaataaagtagtgtggaagataagttaaaactgtcatgttatggttggttttttttcaatttagaagaa
aaaccttatattttacttttatttgtcatttgagaatttaaaaaatttaaataaagggtaggattgacgttaATG

    CAC1013 --- CAC1014 --- CAC1015 --- CAC1016 Gene: CAC1013     GI: 15894300     BI number: CAC1013     GOG: COG0849     Description: FTSA related protein, predicted ATPases of the HSP70 family Gene: CAC1014     GI: 15894301     BI number: CAC1014     GOG: COG1473     Description: IAA-like amino acid hydrolase Gene: CAC1015     GI: 15894302     BI number: CAC1015     GOG: COG0564     Description: Pseudouridylate synthase Gene: CAC1016     GI: 15894303     BI number: CAC1016     GOG: COG2244     Description: SpoVB related membrane protei tg a  t c  t ta gt tg cg at at a  g a  g       tt t  t      a  t t  t      a  a g  t       cg a  |       ta a  |       ta t  |       tg at        ta gt        ta at        ta at        ta gt        ta gc        gc ta        gc             ttatattttacttttatttgtcatttgagaatttaaaaaatttaaataaagggtaggattgacgttaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG0849 Actin-like ATPase involved in cell division ... can be seen here [R] COG1473 Metal-dependent amidase/aminoacylase/carboxypeptidase ... can be seen here [J] COG0564 Pseudouridylate synthases, 23S RNA-specific ... can be seen here [R] COG2244 Membrane protein involved in the export of O-antigen and teichoic acid ... can be seen here     ..................................................................................................................