                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:125 nt.    Distance to gene:62 nt.     Distance to run of Ts=3 nt.   Size=35 nt.     Delta G=-12.10 kcal/mol
Antiterminator:    Distance from promoter:71 nt. Size=61 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTACT-TATGAT. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTACTATAAAGGATAAAGAAGCTAGGTATGATGCAATATCGAATTATATTATATGTC
AAGCTCAAATGAGCACAGCTGGCTTAATGATGGATTATTACGAGAAATATGAGGTTAT
ATACAAAAACCATAGTACATCAGAAATGGTAATGTAAataaaaaaatatagggtttaaattaaataccctata
ttttttcatttttatgtactattttaagataaaaaataatatctatatttatatattaatatataggaggtattatttATG

    CAC1020 --- CAC1021 Gene: CAC1020     GI: 15894307     BI number: CAC1020     GOG: NOG13988     Description: Hypothetical protein Gene: CAC1021     GI: 15894308     BI number: CAC1021     GOG: COG1032     Description: Predicted Fe-S oxidoreductase AT C  C A  A T  G G  A A  A TA AT CG CG AT A  A A  A A  |        t AT       a  t CG       a  a AT       a  a TA       t  a A  A      t  t Ta        ta At        gc Ta        gc Ta        gc G  a       at G  a       ta A  a       at G  a       ta Ta        at At        at Ta        at At        at             ttcatttttatgtactattttaagataaaaaataatatctatatttatatattaatatataggaggtattatttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1032 Fe-S oxidoreductase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_acetobutylicum                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:128 nt.    Distance to gene:73 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -9.40 kcal/mol Antiterminator:    Distance from promoter:91 nt. Size=61 nt.     Delta G= -7.50 kcal/mol Anti-antiterminator:    Distance from promoter:84 nt.    Size=35 nt.     Delta G= -3.90 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTTACT-TATGAT. It has a score value of 66.93 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTTACTATAAAGGATAAAGAAGCTAGGTATGATGCAATATCGAATTATATTATATGTC AAGCTCAAATGAGCACAGCTGGCTTAATGATGGATTATTACGAGAAATATGAGGTTAT ATACAAAAACCATAGTACATCAGAAATGGTAATGTAAataaaaaaatatagggtttaaattaaataccctata ttttttcatttttatgtactattttaagataaaaaataatatctatatttatatattaatatataggaggtattatttATG     CAC1020 --- CAC1021 Gene: CAC1020     GI: 15894307     BI number: CAC1020     GOG: NOG13988     Description: Hypothetical protein Gene: CAC1021     GI: 15894308     BI number: CAC1021     GOG: COG1032     Description: Predicted Fe-S oxidoreductase            ta           a  a           A  a           A  a           T  a           G  a            Ta            At            Aa            Tt            Ga           G  g           T  g AT       A  | C  C       Ag A  A       At T  G       Gt         t G  A       At       a  t A  A      C  a      a  a TA        Ta       a  a AT        A       t  a CG        C       t  t CG        A        ta AT       T         gc A  A      G         gc A  A      A         gc A  |      T         at AT        A        ta CG        C        at AT        C        ta TA        A        at                         tttttcatttttatgtactattttaagataaaaaataatatctatatttatatattaatatataggaggtattatttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1032 Fe-S oxidoreductase ... can be seen here     ..................................................................................................................