                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:88 nt.    Distance to gene:104 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-16.30 kcal/mol
Antiterminator:    Distance from promoter:36 nt. Size=62 nt.     Delta G= -5.04 kcal/mol
Anti-antiterminator:    Distance from promoter:13 nt.    Size=48 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATA-AAAAAT. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATAAGAAGCTTCATTTGGAAAAATTCTCAATAGATATTGATAGGTACATAACTAA
AAAAGAAATTGTGTATAAAGAAATGTATCACATATTTAATTAAatagcattttaaggataatagttta
ttatgaaattttcatgataaactattatttttgtatatatattaatttatttacaataaaagtaataggtgttaatattaataatgactatataattaat
agaagaaatccaagtgtaaaggagagtaatggttatATG

    CAC1022 Gene: CAC1022     GI: 15894309     BI number: CAC1022     GOG: COG3208     Description: Thioesterase II of alpha/beta hydrolase superfamil            AT           A  T            TA            TA            Ta            At AA        Ta A  A      A  | A  G      C  | A  A      A  | T  A      C  | C  A      T  | AT       A  | AT        Tg TG        Gc         t AT        Ta       a  t CG        At        at AT        At        at TA        At        gc GT        Gt        ta |  A      A  a       at |  A      A  a       tg |  A      A  g       ta |  G      T  g       at |  A      A  a       ta |  A      T  t       ta |  A      G  a       ta |  T       Ta        gc G  G       Gt        at AT        Ta        ta TA        Tg        at AT        At        at GC        At        ta TA        At        at                         ttttgtatatatattaatttatttacaataaaagtaataggtgttaatattaataatgactatataattaatagaagaaatccaagtgtaaaggagagtaatggttatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG3208 Predicted thioesterase involved in non-ribosomal peptide biosynthesis ... can be seen here     ..................................................................................................................