                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:147 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-10.90 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -5.32 kcal/mol
Anti-antiterminator:   Size=62 nt.     Delta G=-16.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gttctttattggcattttatcctggaatgccgtggtaaattgataacgttatcttatagttactacatggattactaggcatgtatatttaggatagcgt
atcttgcatttataagaataaaggttaaagcagcttggtacgggctgcttttttagcgtttatacaaatataaaaggataattaagtttagggtagaatt
gtattcatatacatataatgtgatataagtttttagcaggattaataaaaatcttatgtaacaagtgtaaacataataaatgtctttaaggaggaaaatc
ATG

    CAC1044 Gene: CAC1044     GI: 15894331     BI number: CAC1044     GOG: COG0446,COG1902     Description: NADH:flavin oxidoreductase, possible NADH oxidas ac t  t t  a a  g g  g gc ta at cg at ta         t c  t      a  a a  |      a  a t  |      g  a ta       a  g gt       a  g at       t  t t  |       at at        ta ta        ta tg        ta cg       |  g ta       |  c        t at       a  a      g  a ta        cg        gc tg        gc        tg gc       t  t       tg cg       t  t       cg a  |       cg        gc at        tg        at ta        at        cg at        ta        gc gc        gc        at                         tttttagcgtttatacaaatataaaaggataattaagtttagggtagaattgtattcatatacatataatgtgatataagtttttagcaggattaataaaaatcttatgtaacaagtgtaaacataataaatgtctttaaggaggaaaatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0446 Uncharacterized NAD(FAD)-dependent dehydrogenases ... can be seen here [C] COG1902 NADH:flavin oxidoreductases, Old Yellow Enzyme family ... can be seen here     ..................................................................................................................