                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:132 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-14.70 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -4.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aaatatataaaagcttatatgttataaaacctcatatgggggaaattctataaagaatataaaaatttataaaaatcattgcacagaatcaagggttcga
ttcccgcccgagctaccaaagctttaaaatagcgagtttgaagtattgtagacttgctatttttttatttccaagttattttaatacatctacggatttt
agttttactgatttcattgaatagtgacaaggtaacttacgaaacagatggaacaaatcaaatatattacacttacgatagtgatggtaaattactaagc
ATG

    CAC1061 --- CAC1062 Gene: CAC1061     GI: 15894347     BI number: CAC1061     GOG: COG3209     Description: Uncharcterized protein, shares conserved domain among different RHS family proteins and WAPA of B.subtilis Gene: CAC1062     GI: 15894348     BI number: CAC1062     GOG: -------     Description: Hypothetical protei             c           c  a           a  a            ta            cg            gc            at            gt           |  t       ta           |  a      g  t           |  a      a  t           |  a      a  g           |  a       gt           c  t       ta           c  a       tg            cg        ta   c        gc        gc c  c       cg        at t  g      c  a       gt t  c      c  g       cg a  c      t  t       gc gc       t  |       at cg        at        ta ta        gt        at tg        cg        at gc        ta        at gt        ta        at                         tttatttccaagttattttaatacatctacggattttagttttactgatttcattgaatagtgacaaggtaacttacgaaacagatggaacaaatcaaatatattacacttacgatagtgatggtaaattactaagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG3209 Rhs family protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_acetobutylicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:139 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -8.00 kcal/mol Antiterminator: Size=47 nt.     Delta G= -6.80 kcal/mol Anti-antiterminator:   Size=21 nt.     Delta G= -4.60 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case aaatatataaaagcttatatgttataaaacctcatatgggggaaattctataaagaatataaaaatttataaaaatcattgcacagaatcaagggttcga ttcccgcccgagctaccaaagctttaaaatagcgagtttgaagtattgtagacttgctatttttttatttccaagttattttaatacatctacggatttt agttttactgatttcattgaatagtgacaaggtaacttacgaaacagatggaacaaatcaaatatattacacttacgatagtgatggtaaattactaagc ATG     CAC1061 --- CAC1062 Gene: CAC1061     GI: 15894347     BI number: CAC1061     GOG: COG3209     Description: Uncharcterized protein, shares conserved domain among different RHS family proteins and WAPA of B.subtilis Gene: CAC1062     GI: 15894348     BI number: CAC1062     GOG: -------     Description: Hypothetical protei             c           a  c           t  a            ca            ga            ag            gc            ct           |  t           |  t           |  a           |  a           |  a           c  a           c  t       ta            ga       g  t   c        cg       a  t c  c       cc       a  g t  g      c  g       gt t  c      t  a       ta a  c      t  g       tg gc       a  |       ta cg        gt        gc ta        ct        at tg        tt        gt gc        tg        cg gt        ga        gc                         tatttttttatttccaagttattttaatacatctacggattttagttttactgatttcattgaatagtgacaaggtaacttacgaaacagatggaacaaatcaaatatattacacttacgatagtgatggtaaattactaagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG3209 Rhs family protein ... can be seen here     ..................................................................................................................