                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:163 nt.    Distance to gene:0 nt.     Distance to run of Ts=3 nt.   Size=25 nt.     Delta G= -6.50 kcal/mol
Antiterminator:    Distance from promoter:149 nt. Size=23 nt.     Delta G= -9.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTAAA-TACAAA. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTAAATACTCAGATAAGCACTCTTACAAATCAAAATACTATTCTAAATGAGAAAATT
AAAAACATAAATAATGCAGTATCTCAAACTTCTGCGGATAACATTACGACAGGGGCTA
TAGATACAGCTAAAATAGCAACAGTAGGAACTATAAGTAATGGACAAATAGCGAAATA
AttttagagtaagactttatcttactctttttataagagaaagaaggttctttATG

    CAC1106 --- CAC1105 --- CAC1104 Gene: CAC1106     GI: 15894391     BI number: CAC1106     GOG: -------     Description: Hypothetical protein Gene: CAC1105     GI: 15894390     BI number: CAC1105     GOG: -------     Description: Hypothetical protein Gene: CAC1104     GI: 15894389     BI number: CAC1104     GOG: -------     Description: Hypothetical protei             t   t       t  a t  t      t  t c  a       ta at        ta gc        cg at        ta at        cg ta       a  a gc        ta at        ta gc        cg at        ta             aggttctttATG     ..................................................................................................................