Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:150 nt.    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -7.10 kcal/mol
Antiterminator:    Distance from promoter:85 nt. Size=72 nt.     Delta G= -9.10 kcal/mol
Anti-antiterminator:    Distance from promoter:68 nt.    Size=43 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TAGAAT-TATAAT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAGAATACCTACTCGTATTATTCAATATAATATGGGCATACAGTTTGATGGTATATAT
GGACGAGATACCGCAAGTCATGTACAAGCATGGCAATCATCTCATAGTTTAAAATCAG
ATGGGTTGTTTGGTTCTCAATCGTGGTTAACTTTATTGTCAAAATAAataaaaatagagaaaata
attccatgcaataaattacatggaattttattataaggagagatgtataaATG

    CAC1107


Gene: CAC1107     GI: 15894392     BI number: CAC1107     GOG: -------     Description: Hypothetical protein, CF-36 famil


            C
          T  A
          G  A
           TA
           TA
           AT
           TA
           TA
           Ta
          C  |
          A  |
           At
           Ta
           Ta
          G  a
          G  a
           Ta
           Gt
          C  a
  G       T  |
G  T      A  |
G  T      A  |
 TG        Cg
 AT        Ta
 GT        Cg
 AT        Ta
 CG       T  |
 TG       G  |
 AT       G  |       aa
 AT        Ta       t  a
A  C       Ta       a  t
A  T       Ta       a  t
T  C       Gt       c  a
 TA        Ta        gc
 TA        Ta        ta
 GT       |  t       at
A  C       Gt        cg
T  G       Gc        cg
 AT        Gc        ta
 CG        Ta        ta
 TG        At        at
                        tttattataaggagagatgtataaATG


    ..................................................................................................................