Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:153 nt.    Distance to gene:68 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -6.80 kcal/mol
Antiterminator:    Distance from promoter:89 nt. Size=69 nt.     Delta G= -9.99 kcal/mol
Anti-antiterminator:    Distance from promoter:64 nt.    Size=36 nt.     Delta G= -8.04 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TCTAAA-TAAAAT. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTAAAATAAATAAAAAGTTTTCTAAAATTTTATATACAACAGAAGATGGGACAAACT
TTTTTGCCCCCGATTATAATTCTATTTTGCCCTATATTATTGGCGCAATACAAGAATT
AAGTGCCAAAAGTAAAAGTTTAGAAACTAGAGTAACTACTTTAGAAAATTCTATTCAA
GAGTTAAAAGCATCCAAATAGggtgttatttttatataaaaagaaagtgtaatgaaagcaagaatgttttatatcgtttagctat
aaatggttgctttttgGTG

    CAC1112


Gene: CAC1112     GI: 15894397     BI number: CAC1112     GOG: -------     Description: Hypothetical protein, CF-11 famil


           AC
          A  T
           TA
           GC
           AT
           GT
           AT
           TA
           CG
          |  A
          |  A
          |  A
          A  A
           AT
           AT
           GC
           AT
           TA
 AG       T  T
A  A      T  T
C  A      G  C
A  T      A  A
T  T      A  A
A  A      A  G
A  A      A  A
 CG       T  G
 GT       G  T        A
 CG       A  T      A  T
 GC       A  A      A  A
 GC       A  A       CG
 TA       A  A       Cg
 TA       C  A       Tg
A  A       CG        At
 TA        GC        Cg
 TG        TA        Gt
 AT        GT        At
                        atttttatataaaaagaaagtgtaatgaaagcaagaatgttttatatcgtttagctataaatggttgctttttgGTG


    ..................................................................................................................