Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-11.80 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCAGGTGGTTACTGCGCAAAAAACTCAAAGTATAGTTAATTTTGCTGAGAATATTCCT
AATTTAATGGCGTCTATAAGAACACCAAAAATTATTTTACCTAGTAGTTTAAATGTTA
ATGGAAATAGTCCTAATTCTAGTGGATTAGCTAATCAAAGAGTCTTTCATATAAATAA
CCTAAATGTCCAAGCGAATGATGCAAAACAACTAATAAAAAGCTTGGAACTAATGGTT
GAAACAGGAGATTATTAAagtgttaggttttaaaatctaacacttctttttaataggaggttatttaaATG

    CAC1119 --- CAC1118


Gene: CAC1119     GI: 15894404     BI number: CAC1119     GOG: -------     Description: Hypothetical protein
Gene: CAC1118     GI: 15894403     BI number: CAC1118     GOG: -------     Description: Phage related protei


            C
          A  A
          A  G
          A  G
 AC       G  A
A  A       TG
A  A       TA
A  C       GT
C  T       GT
G  A       TA
 TA        AT        ta
 AT        AT       t  a
G  A      |  A       ta
T  A      |  A       ta
A  A       Ta        gt
A  A       Cg        gc
G  A       At        at
 CG       A  g       ta
 GC        Gt        ta
 AT        Gt        gc
 AT        Ta        ta
 CG        Tg        gc
 CG        Cg        at
 TA        Gt        At
                        ctttttaataggaggttatttaaATG


    ..................................................................................................................