                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-14.40 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=74 nt.     Delta G=-14.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTCATCAGGATCATTTAGTAATACTATTTTAGATAAGAGCCTTTTATATATTGTCCC
AACAGGTCAAAACGATAAAAGATCCCTAAAAGTAGCAAAAGAAAAAGCAATTCCAACT
ATAGATGATCTCCACTTAGAAGATAGATCCTACGAGATGAGAATGGATGCTGTTTTTG
GTGCTGGGTTAGTATTTGGAGATAAATGCTATATAGGAGCGTATAAAGATCTTTCTAT
TTCTTAAtctaagtagagaatttttttaattctctacttattatttgtataaagaaggagttaatataATG

    CAC1129 --- CAC1128 --- CAC1127 --- CAC1126 --- CAC1125 --- CAC1124 Gene: CAC1129     GI: 15894413     BI number: CAC1129     GOG: -------     Description: Hypothetical protein Gene: CAC1128     GI: 15894412     BI number: CAC1128     GOG: -------     Description: Hypothetical protein Gene: CAC1127     GI: 15894411     BI number: CAC1127     GOG: -------     Description: Hypothetical protein Gene: CAC1126     GI: 15894410     BI number: CAC1126     GOG: -------     Description: Hypothetical protein Gene: CAC1125     GI: 15894409     BI number: CAC1125     GOG: -------     Description: Hypothetical protein Gene: CAC1124     GI: 15894408     BI number: CAC1124     GOG: -------     Description: Hypothetical protei AG G  A GT TA TA TA AT TG GC AT TA |  T TA GT |  A G  G G  G TA CG GC        AA |  G      T  t T  T      T  c G  A      C  t GT        Ta         t TA        Ta       t  t TA        Tg       t  t TA        At        ta TG        Ta        ta TA        Cg        at GT        Ta        at T  C       Tg        gc C  T       Ta        at G  T      C  a       gc T  |      T  t       at AT        At        ta GC        Gt        gc GT        At        at TA        At        at AT        At        ta                         ttatttgtataaagaaggagttaatataATG     ..................................................................................................................