                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:125 nt.    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G= -8.50 kcal/mol
Antiterminator:    Distance from promoter:66 nt. Size=77 nt.     Delta G= -8.97 kcal/mol
Anti-antiterminator:    Distance from promoter:57 nt.    Size=45 nt.     Delta G= -4.11 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TTTATT. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAATATTTGCGTTGAGATATTTATTGGTAGGTCTTTCTCTGGCACAGATGAATA
TGCTAAAGACAAAAACTTATTTAGCAAAGCTGGACAAAGACTATTCCTTTATGAGGAT
GGCAAAAGACTAAGTATTCAAGATATTGTTTTTAATTAAaaatatatgggaagtttaattcttccctattt
ttttattatattatatgagaagatattcatgtATG

    CAC1135 --- CAC1134 --- CAC1133 Gene: CAC1135     GI: 15894419     BI number: CAC1135     GOG: -------     Description: Hypothetical protein Gene: CAC1134     GI: 15894418     BI number: CAC1134     GOG: NOG13847     Description: Phage related protein, YonF B.subtilis homolog Gene: CAC1133     GI: 15894417     BI number: CAC1133     GOG: -------     Description: Phage related protein, YonE B.subtilis homolo             A           C  A            TG            TA            AT            TA            GT            AT           A  |           T  |            CG            AT            GT            AT            AT            AT           A  A   A       C  A T  T      G  T TG       G  T TA       T  A CG       A  A CG       G  a        a T  |      G  a      t  a TA       A  a      t  t AT        Gt       t  t TG        Ta        gc CG        At        at |  C       Ta        at A  A      T  t       gc G  A       Tg        gc A  A       Cg        gc A  A       Cg       t  | A  G       Ta       a  | C  A      T  |      t  | A  C      A  |       at G  T       Ta        ta G  A       Cg        at TA        At        at CG        Gt        at GT        At        At                         tttattatattatatgagaagatattcatgtATG     ..................................................................................................................