Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:117 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-16.30 kcal/mol
Antiterminator: Size=72 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTACCTTGATTGCTGTTTTAGAAGAAGCTGATGAGAACTTCATTTTAAAGATGAAAA
CTTATCTTGATTCGCTGAAGGATGGGTGGAGGATATTTGAGGTAGAAAACGATAATAA
TGGCGCAGTTATAATATAGtttagtgaaaattcatcttgttttattagcaaggtgaatttttctttttaaatcataaaaatattat
gaaagcatatatatatcatatagaaaatagtttaattaacaatttacatacacaaaaatataagttatacataaatttaatattttaggaggaatgttAT
G

    CAC1236


Gene: CAC1236     GI: 15894519     BI number: CAC1236     GOG: -------     Description: Hypothetical protei


            G
          G  C
          T  G
          A  C
          A  A
           TG
           AT
           AT
           TA
           AT
          G  A
          C  A
          A  T
 GG       A  A
A  A      A  |
A  T      A  |
G  G      G  |
 TG        AT
 CG        TA
 GT       G  G        a
 CG        Gt       t  t
 TG        At       t  t
 TA        Gt        ta
|  G       Ta        tg
|  G       Tg        gc
|  A      T  t       ta
|  T      A  g       ta
|  A      T  a       cg
|  T      A  a       tg
 AT       G  a       at
 GT       G  a       cg
 TG        At        ta
 TA        Gt        ta
 CG        Gc        at
 TG        Ta        at
 AT        Gt        at
 TA        Gc        at
 TG        Gt        gt
                        ctttttaaatcataaaaatattatgaaagcatatatatatcatatagaaaatagtttaattaacaatttacatacacaaaaatataagttatacataaatttaatattttaggaggaatgttATG
    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:52 nt.    Distance to gene:124 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-10.30 kcal/mol
Antiterminator:    Distance from promoter:16 nt. Size=72 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATT-GATATT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATTCGCTGAAGGATGGGTGGAGGATATTTGAGGTAGAAAACGATAATAATGGCGC
AGTTATAATATAGtttagtgaaaattcatcttgttttattagcaaggtgaatttttctttttaaatcataaaaatattatgaaagcatata
tatatcatatagaaaatagtttaattaacaatttacatacacaaaaatataagttatacataaatttaatattttaggaggaatgttATG

    CAC1236


Gene: CAC1236     GI: 15894519     BI number: CAC1236     GOG: -------     Description: Hypothetical protei



  c
t  a
t  t
a  c
a  t
 at
 ag
 gt
 tt
 gt
a  t
t  a
t  t
t
G  |
A  |
T  |
 A
 T
A
 A
 T
 A
 T
 T
G          a
A        t  t
C        t  t
G         ta
C         tg
G         gc
 G        ta
 T        ta
 A        cg
 A        tg
 T        at
 A        cg
 A        ta
            atttttctttttaaatcataaaaatattatgaaagcatatatatatcatatagaaaatagtttaattaacaatttacatacacaaaaatataagttatacataaatttaatattttaggaggaatgttATG
    ..................................................................................................................