Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:152 nt.    Distance to gene:45 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-11.30 kcal/mol
Antiterminator:    Distance from promoter:88 nt. Size=72 nt.     Delta G= -8.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGACT-TATAGT. It has a score value of 70.95 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGACTGAAGATGAAATTAGAATTATAGTTAAGGATGCAGCAGATAGCGTTGGTGCTA
GTAACATGAAGGACATGGGAAAAGTCATGTCGGCTTTAATGTCAAAAGTTAAAGGGCG
CGCAGATGGTTCCTTGGTAAGTAAACTTGTAAAAGAGTTTTTAAATAATAAATAAgaaa
atgaaggacctggtttatccaggtcttttttgttgtaattaaatcctttttccattcataaattagtatgaaagtgtgcgtttgagggtgagaggATG


    CAC1290 --- CAC1291


Gene: CAC1290     GI: 15894572     BI number: CAC1290     GOG: NOG09693     Description: Uncharacterized protein, homolog of YQFC B.subtilis
Gene: CAC1291     GI: 15894573     BI number: CAC1291     GOG: NOG07111     Description: Uncharacterized protein, YQFD ortholog, related spoIV gene produc


 AA
T  A
G  A
 TG
 TA
 CG
 AT
 AT
 AT
|  T
|  T
|  A
|  A
|  A
|  T
|  A
|  A
|  T
|  A
|  A
|  A
|  T
|  A
|  A
T  g
G  a
A  a
A  a
 Ta
 Gt
G  g
 Ta
 Ta
 Cg
 Cg
T  |        t
 Ta       t  a
 Gc       t  t
 Gc        gc
T  t       gc
A  g       ta
G  |       cg
A  |       cg
 Cg        at
 Gt        gc
            ttttttgttgtaattaaatcctttttccattcataaattagtatgaaagtgtgcgtttgagggtgagaggATG


    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:149 nt.    Distance to gene:63 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-14.40 kcal/mol
Antiterminator:    Distance from promoter:113 nt. Size=72 nt.     Delta G= -8.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGACT-TATAGT. It has a score value of 70.95 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGACTGAAGATGAAATTAGAATTATAGTTAAGGATGCAGCAGATAGCGTTGGTGCTA
GTAACATGAAGGACATGGGAAAAGTCATGTCGGCTTTAATGTCAAAAGTTAAAGGGCG
CGCAGATGGTTCCTTGGTAAGTAAACTTGTAAAAGAGTTTTTAAATAATAAATAAgaaa
atgaaggacctggtttatccaggtcttttttgttgtaattaaatcctttttccattcataaattagtatgaaagtgtgcgtttgagggtgagaggATG


    CAC1290 --- CAC1291


Gene: CAC1290     GI: 15894572     BI number: CAC1290     GOG: NOG09693     Description: Uncharacterized protein, homolog of YQFC B.subtilis
Gene: CAC1291     GI: 15894573     BI number: CAC1291     GOG: NOG07111     Description: Uncharacterized protein, YQFD ortholog, related spoIV gene produc


 ga
A  a
A  a
 Ta
 At
 Ag
 Aa
 Ta
 Ag
|  g
|  a
|  c
|  c
|  t
|  g
|  g
|  t
|  t
|  t
|  a
|
|
|
|
A
T
A
A
 A
 T
T
 T
 T         t
 T       t  a
 G       t  t
A  |       gc
 G        gc
 A        ta
 A        cg
A         cg
A         at
T  |       gc
G  |       gt
 T        at
 T        at
            tttgttgtaattaaatcctttttccattcataaattagtatgaaagtgtgcgtttgagggtgagaggATG


    ..................................................................................................................