                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G= -9.30 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.20 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-15.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGAAGAGAAAGTTTTAAGACTTAGATTTGGTCTCGATGATGGAAGAGCTAGAACACTT
GAAGAGGTTGGAAAAGAGTTTAATGTTACAAGAGAGAGAATAAGGCAGATAGAAGCAA
AAGCTCTTAGAAAACTAAGACATCCAAGTAGAAGCAAAAAATTAAAAGATTATCTTGA
TTAAtaaatactaaggttatccttaatgggtggcctttttatttttagctaaatatattggaagagtacctctctttcaactgatttttatttatga
tataattatgtataaaagaaggtgagaaaTTG

    CAC1301 --- CAC1302 --- CAC1303 Gene: CAC1301     GI: 15894583     BI number: CAC1301     GOG: NOG12304     Description: Predicted membrane protein Gene: CAC1302     GI: 15894584     BI number: CAC1302     GOG: COG2384     Description: Predicted SAM-dependent methyltransferase Gene: CAC1303     GI: 15894585     BI number: CAC1303     GOG: COG0327     Description: Uncharacterized protein of YbgI/Acr famil            ag           t  c           t  t   a        ta t  a       ta         c t  t       ta       a  c cg        at       t  t cg        ta        gc tg       |  t       at at       |  a       gc tg       |  t       at tg       |  t       at gc        tg        gt gc        tg        gc at        ta        ta at        ta        ta t  t       cg       a  c c  t      c  a      t  t at       g  g      a  g ta        gt        ta at        ta        at at        gc        at at        gc        at                         ttatttatgatataattatgtataaaagaaggtgagaaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2384 Predicted SAM-dependent methyltransferase ... can be seen here [S] COG0327 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_acetobutylicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:81 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-12.40 kcal/mol Antiterminator: Size=14 nt.     Delta G= -3.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GGAAGAGAAAGTTTTAAGACTTAGATTTGGTCTCGATGATGGAAGAGCTAGAACACTT GAAGAGGTTGGAAAAGAGTTTAATGTTACAAGAGAGAGAATAAGGCAGATAGAAGCAA AAGCTCTTAGAAAACTAAGACATCCAAGTAGAAGCAAAAAATTAAAAGATTATCTTGA TTAAtaaatactaaggttatccttaatgggtggcctttttatttttagctaaatatattggaagagtacctctctttcaactgatttttatttatga tataattatgtataaaagaaggtgagaaaTTG     CAC1301 --- CAC1302 --- CAC1303 Gene: CAC1301     GI: 15894583     BI number: CAC1301     GOG: NOG12304     Description: Predicted membrane protein Gene: CAC1302     GI: 15894584     BI number: CAC1302     GOG: COG2384     Description: Predicted SAM-dependent methyltransferase Gene: CAC1303     GI: 15894585     BI number: CAC1303     GOG: COG0327     Description: Uncharacterized protein of YbgI/Acr famil             a           t  a           t  t            cg            cg            tg ta        at t  t       tg gc        tg gc        gc at        gc at        at ta        at             tttatttttagctaaatatattggaagagtacctctctttcaactgatttttatttatgatataattatgtataaaagaaggtgagaaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2384 Predicted SAM-dependent methyltransferase ... can be seen here [S] COG0327 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_acetobutylicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -6.60 kcal/mol Antiterminator: Size=14 nt.     Delta G= -3.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GGAAGAGAAAGTTTTAAGACTTAGATTTGGTCTCGATGATGGAAGAGCTAGAACACTT GAAGAGGTTGGAAAAGAGTTTAATGTTACAAGAGAGAGAATAAGGCAGATAGAAGCAA AAGCTCTTAGAAAACTAAGACATCCAAGTAGAAGCAAAAAATTAAAAGATTATCTTGA TTAAtaaatactaaggttatccttaatgggtggcctttttatttttagctaaatatattggaagagtacctctctttcaactgatttttatttatga tataattatgtataaaagaaggtgagaaaTTG     CAC1301 --- CAC1302 --- CAC1303 Gene: CAC1301     GI: 15894583     BI number: CAC1301     GOG: NOG12304     Description: Predicted membrane protein Gene: CAC1302     GI: 15894584     BI number: CAC1302     GOG: COG2384     Description: Predicted SAM-dependent methyltransferase Gene: CAC1303     GI: 15894585     BI number: CAC1303     GOG: COG0327     Description: Uncharacterized protein of YbgI/Acr famil             a           t  a           t  t AT        cg A  T       cg AA        tg AA        at AA        tg AA        tg CG        gc             ctttttatttttagctaaatatattggaagagtacctctctttcaactgatttttatttatgatataattatgtataaaagaaggtgagaaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2384 Predicted SAM-dependent methyltransferase ... can be seen here [S] COG0327 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................