Gene putatively regulated by attenuation in C_acetobutylicum
Characteristics of the secondary structures
Terminator: Distance from promoter:88 nt. Distance to gene:141 nt. Distance to run of Ts=1 nt. Size=22 nt. Delta G= -6.10 kcal/mol
Antiterminator: Distance from promoter:51 nt. Size=45 nt. Delta G= -6.40 kcal/mol
Anti-antiterminator: Distance from promoter:12 nt. Size=47 nt. Delta G=-14.40 kcal/mol
Nomenclature/Definitions
The most likely promoter is: cttact-taaaat. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
cttacttcaattcagagtgccgtaaaataactaatatatcagatgagtatctggtgtaatgcaaaaaaacatttcaggtgcttattttgcttttcattaa
ttgaaaacaaacaagaatctgggcctaattgccaagatgttttataaaataagtaataagccttttatcattattcatagttctgctttataccaaaatt
ataattatttaatccatgtatgtaatattgaggtaaattatgctattatataattaaatgcaaattatagagtagaaagataaaaATG
CAC1312 --- CAC1313
Gene: CAC1312 GI: 15894592 BI number: CAC1312 GOG: ------- Description: Hypothetical protein
Gene: CAC1313 GI: 15894593 BI number: CAC1313 GOG: ------- Description: Hypothetical protei
a
aa t a
a a t t
a a at
c a cg
gc ta
ta ta
at ta
at ta
t | | c
g | | a
t | | a
gt c a
gc gc
ta ta
cg ta aa
tg tg t t
at ta c t
tg | a cg
gc | t gc
at | c gc
gt at g a
ta tg ta
at tg cg
gt cg ta
at gc at
gttttataaaataagtaataagccttttatcattattcatagttctgctttataccaaaattataattatttaatccatgtatgtaatattgaggtaaattatgctattatataattaaatgcaaattatagagtagaaagataaaaATG
..................................................................................................................