                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:118 nt.    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-14.80 kcal/mol
Antiterminator:    Distance from promoter:92 nt. Size=39 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:    Distance from promoter:59 nt.    Size=48 nt.     Delta G=-14.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgact-ttcatt. It has a score value of 70.28 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgactcgaaatttaaaatttttttcatttgtaaacgatgtaaaaaatacactttattacagataccgtttacatttcaccattatattgacatattgct
gataaatgttatataatacaatttatcagcgtgttaccaacacgggcaaaagctgaaaaaggaagtactctttttttggctttttttgttgtctaaaaat
aaacttattaacaatttacttttatttaatttaaggagggctttattTTG

    CAC1353 Gene: CAC1353     GI: 15894632     BI number: CAC1353     GOG: COG1263,COG1264     Description: Phosphotransferase system IIC component, possibly N-acetylglucosamine-specifi at t  a a  a t  t ta         c gc       a  a |  a      a  c ta        cg         t at        cg       g  a at       a  |      a  c at       t  |       at ta        tg        gc at        gc        gt gc        ta        at ta       |  a       at cg       |  a       at gc       g  a       at t  |       cg        at t  |       gc       g  t a  |       at       t  g tg        cg        cg at        ta        gc cg       a  a       at at        ta        at gt        ta        at ta        ta        at                         tttgttgtctaaaaataaacttattaacaatttacttttatttaatttaaggagggctttattTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1263 Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific ... can be seen here [G] COG1264 Phosphotransferase system IIB components ... can be seen here     ..................................................................................................................