                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:32 nt.    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-16.10 kcal/mol
Antiterminator:    Distance from promoter:14 nt. Size=36 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -3.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tatact. It has a score value of 76.31 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaaatgggtaaaaggaatattatactagtgaggtaaaaaataaaacgtgtaactttcgaataaggcatgagttttaacttgtgccttattattttt
tgcaaaagggtatacgttatatgggaggaatacaaATG

    CAC1354 Gene: CAC1354     GI: 15894633     BI number: CAC1354     GOG: COG2190     Description: Phosphotransferase system IIA componen   a a  a a  a ta gt g  a       ga a  a      c  a g  a      t  t       tt ta        ta       t  a gc        ta        ta a  |       cg        gc t  |      a  g       at cg       a  c      g  t at        ta       t  g tg        gt        at at       t  g       cg ta       g  a       gc ta        cg        gc a  c       at        at t  t       at        at at        at        ta at        at        at gc        ta        at                         attttttgcaaaagggtatacgttatatgggaggaatacaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG2190 Phosphotransferase system IIA components ... can be seen here     ..................................................................................................................