                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:153 nt.    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-11.40 kcal/mol
Antiterminator:    Distance from promoter:117 nt. Size=47 nt.     Delta G=-10.10 kcal/mol
Anti-antiterminator:    Distance from promoter:99 nt.    Size=44 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TAGTTT-TAGAAT. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAGTTTTTTCTAATAATGGATATGCTAGAATGACATTCTTTACGAATAAATTTAGGGT
CCCACAAGTCATAGGAAAATCTGTAGTATTGCATGAAAGTCCAGACGATTATAGGACA
CAACCAGCAGGAGCATCTGGGAGAAAAGTAGCGTGTGGTGTTATTAGAGCTGTTAGAT
AAtagctttttaaaggggcatataagtccctttatttttatgtaatggaggattaaatagtacataaaattaaggtatgtatggagagggttacATG

    CAC1364 Gene: CAC1364     GI: 15894643     BI number: CAC1364     GOG: COG1502     Description: Enzyme from phospholipase D family, possible endonuclease nu            GA   T       A  T G  G       TA T  G       TA GT        Gt CG        Ta GT        Cg AT        Gc TA        At GT        Gt AT        At |  A      T  t A  G      T  |       at A  A       At       t  a A  G       Ta       a  a GC        Ta        cg AT       G  a       gt G  G      T  g       gc GT       G  g       gc GT       G  g       gc TA        Tg        at CG        Gc        at TA        Ta        at AT        Gt        ta                         tttttatgtaatggaggattaaatagtacataaaattaaggtatgtatggagagggttacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1502 Phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthases and related enzymes ... can be seen here     ..................................................................................................................