                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:67 nt.    Distance to gene:38 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -7.30 kcal/mol
Antiterminator:    Distance from promoter:30 nt. Size=65 nt.     Delta G=-18.60 kcal/mol
Anti-antiterminator:    Distance from promoter:27 nt.    Size=37 nt.     Delta G= -6.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgagc-tagtat. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgagccaggatacttgccatattctagtatgttttttctacgagcgataggaggaataatcatgaagtataaccataggtgtactatatgcatttggcc
ttttaacgtattgttaaggggctttttattttatcagaataattttcaaaagggagtgtttatATG

    cbiM --- CAC1366 --- cbiQ Gene: cbiM     GI: 15894644     BI number: CAC1365     GOG: COG0310     Description: Cobalamin biosynthesis protein CbiM Gene: CAC1366     GI: 15894645     BI number: CAC1366     GOG: -------     Description: Predicted membrane protein Gene: cbiQ     GI: 15894646     BI number: CAC1367     GOG: COG0619     Description: Cobalt permeas             t           a  t            ct            gg           t  |            ag            tc            ac            tt            ct            at           t  t            ga            ta   t        gc a  a       gg cg       |  t cg        aa a  |       tt at        a tg       c at       c ta       a          a gc        a       t  t at        t       g  t a  a       a        cg gt        t        at ta        g        at at        a        ta cg        a        ta |  c      g         tg ta        t        tg at        a        cg at        c        cg                         ctttttattttatcagaataattttcaaaagggagtgtttatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0310 ABC-type Co2+ transport system, permease component ... can be seen here [P] COG0619 ABC-type cobalt transport system, permease component CbiQ and related transporters ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................