Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:48 nt.    Distance to gene:112 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -8.70 kcal/mol
Antiterminator:    Distance from promoter:17 nt. Size=47 nt.     Delta G= -5.70 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G= -4.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TGGACT-TAAATT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGACTTTAATCAATATCATATAAATTTTTCAGCAGTCTCTGCATTTGTATCCCAGCT
GTATAATAAAAATTTACTGCAGTACTCTATAGAGGATGGAAAGCTGTATTATTTTAAA
AAACCACAATAGtatttacaattataattgacaaggaatgaatagaatgataatattttattcatattatgaacaaaatgaacattctagc
ttaataggtgataaaaATG

    CAC1404


Gene: CAC1404     GI: 15894683     BI number: CAC1404     GOG: COG1349     Description: Transcriptional regulator of sugar metabolism (deoR family


            A
          A  A
          A  A
          T  T
           AT
  C        AT
T  T       TA
 GC       |  C
 AT        AT
 CG        TG         A
 GC        GC       G  G
A  |       TA       A  G
C  |       CG        TA
T  |       GT        AT
T  |      A  A       TG
T  |      C  C       CG
T  |      C  T       TA
 TA       C  C      C  A
 AT       T  |      A  A
 AT        AT        TG
 AT        TA        GC
 TG        GT        AT
 AT        TA        CG
 TA        TG        GT
 AT        TA        TA
                        TTATTTTAAAAAACCACAATAGtatttacaattataattgacaaggaatgaatagaatgataatattttattcatattatgaacaaaatgaacattctagcttaataggtgataaaaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[KG] COG1349 Transcriptional regulators of sugar metabolism ... can be seen here

    ..................................................................................................................