                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:126 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-16.00 kcal/mol
Antiterminator: Size=57 nt.     Delta G= -6.81 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAATATTGAAATACCTAATACTATTTTCTTTGGAGTAATAGTTGTTGTTTTTGGTGGA
ACTATAGCATTTCACTATATACGACAAGCAGGTGTTAAATCTCAAAAACAGAATTAAa
gtaagagaactttccgcagtttgaagctaatttaaaattggttttgaactgtttttttatagaataaagaaaatctgtttttttgctttttcaaaatgat
gtagacaatataattgacgcggtctcggaaataatctaatatagatatatatgtaatttatggatatgaggaaggggggataatATG

    CAC1416 --- CAC1417 --- CAC1418 --- CAC1419 Gene: CAC1416     GI: 15894695     BI number: CAC1416     GOG: COG0454     Description: Predicted acetyltransferase Gene: CAC1417     GI: 15894696     BI number: CAC1417     GOG: -------     Description: Hypothetical protein Gene: CAC1418     GI: 15894697     BI number: CAC1418     GOG: COG0778     Description: Nitroreductase family protein Gene: CAC1419     GI: 15894698     BI number: CAC1419     GOG: COG1619     Description: Uncharacterized proteins, homologs of microcin C7 resistance protein Mcc   A A  T G  T A  A C  A A  a A  g A  t A  a A  a Cg Ta         a Cg       t  a Ta        ta |  a       ta A  c       at At        at At        tg T  t       cg T  c       gt Gc        at Tg        at Gc       g  t G  a      t  g A  |       ta Cg        ta Gt        gc At        at At        cg Cg        gt             ttttttatagaataaagaaaatctgtttttttgctttttcaaaatgatgtagacaatataattgacgcggtctcggaaataatctaatatagatatatatgtaatttatggatatgaggaaggggggataatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KR] COG0454 Histone acetyltransferase HPA2 and related acetyltransferases ... can be seen here [C] COG0778 Nitroreductase ... can be seen here [V] COG1619 Uncharacterized proteins, homologs of microcin C7 resistance protein MccF ... can be seen here     ..................................................................................................................