                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:49 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-13.30 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -4.40 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCGTAGCACCAGGACCTATCTGGACACCACTTATACCAGCTAGTTTTTCAGCTGCAA
GAGTTGCAACCTTTGGAAAAGATACTCCTATGAAGAGAGCTGGTCAACCGTATGAACT
TGCTCCTGCATATGTGTATTTGGCATCTGATGATTCCAGCTATGTTACTGGTGAGGTA
ATTCACATAAATGGTGGAAGAATGGTAACCACTTAAtgcttgggtgctgtattaagcagcatcctttttaaat
tttattagtgatataattaaagtaggttaaagaaaagaagtggagtgttaagtATG

    CAC1424 --- CAC1425 Gene: CAC1424     GI: 15894703     BI number: CAC1424     GOG: COG0491     Description: Zn-dependent hydrolase, glyoxylase II family Gene: CAC1425     GI: 15894704     BI number: CAC1425     GOG: COG0756     Description: DUTPase, du TA G  A GT AT GC TA GC |  A |  T |  A |  A        g |  A      t  c G  T       At TG        At CG        Tg AT        Tg         t TG        Cg       t  a TG        At       a  a |  A       Cg        tg |  A      |  c       gc |  G      C  t       ta G  A      A  g       cg TA        At        gc AT        Ta        ta TG        Gt        gt CG        Gt        gc GT        Ta        gc                         tttttaaattttattagtgatataattaaagtaggttaaagaaaagaagtggagtgttaagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0491 Zn-dependent hydrolases, including glyoxylases ... can be seen here [F] COG0756 dUTPase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_acetobutylicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:58 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-13.30 kcal/mol Antiterminator: Size=32 nt.     Delta G= -4.40 kcal/mol Anti-antiterminator:   Size=44 nt.     Delta G=-10.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GCCGTAGCACCAGGACCTATCTGGACACCACTTATACCAGCTAGTTTTTCAGCTGCAA GAGTTGCAACCTTTGGAAAAGATACTCCTATGAAGAGAGCTGGTCAACCGTATGAACT TGCTCCTGCATATGTGTATTTGGCATCTGATGATTCCAGCTATGTTACTGGTGAGGTA ATTCACATAAATGGTGGAAGAATGGTAACCACTTAAtgcttgggtgctgtattaagcagcatcctttttaaat tttattagtgatataattaaagtaggttaaagaaaagaagtggagtgttaagtATG     CAC1424 --- CAC1425 Gene: CAC1424     GI: 15894703     BI number: CAC1424     GOG: COG0491     Description: Zn-dependent hydrolase, glyoxylase II family Gene: CAC1425     GI: 15894704     BI number: CAC1425     GOG: COG0756     Description: DUTPase, du TA G  A GT AT GC TA GC G  A        G T  T      A  A C  A       AA A  A       GT T  |       GG T  |       TG         t G  |       GT       t  a TA        GA       a  a AT        TA        tg TG       |  C       gc CG       A  C       ta G  |      A  A       cg AT        AC        gc CG        TT        ta CG        AT        gt TA        CA        gc TA        AA        gc                         tttttaaattttattagtgatataattaaagtaggttaaagaaaagaagtggagtgttaagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0491 Zn-dependent hydrolases, including glyoxylases ... can be seen here [F] COG0756 dUTPase ... can be seen here     ..................................................................................................................