                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:154 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-16.10 kcal/mol
Antiterminator: Size=70 nt.     Delta G=-11.50 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGTTTTAAAAGTTAAGGTTGAAGAGGTAAAAGAACTGTCATCAAGTGATAGAGGCAC
TGGAGGTTTTGGTTCCACTGGACTAAAAAAATAGtaggtattatataaatctaacataagtatttaaacttatgt
tagatttttttatttcacaatttaattataaatataaatattgcataaaaatcgttaataaaaacatctatttgataataaaatattaaaaaaatattat
ttttttatgataaaataatatcaagtaaaacctacataatatataacatgttaaagggggtaaagatATG

    CAC1426 Gene: CAC1426     GI: 15894705     BI number: CAC1426     GOG: COG2508     Description: Possible transcriptional regulator from leucine-rich protein (LRPR) famil            AC           C  T            CG            TG            TA            GC            GT            TA            TA            TA            TA   G       G  A A  A      G  A T  G      A  A A  G      G  | GC        GT TA        TA GC        CG AT        At A  G      |  a C  |      |  g T  |       Cg A  |       Gt CG       |  a       tt TA       |  t      t  a G  |      |  t      a  a TG       |  a       ta CG       |  t       gc AT       |  a       at AT       |  t       at GT       |  a       ta AT       |  a       at A  G      G  a       cg A  G       At        at A  T       Gc        at T  T       At        ta GC        Ta        cg GC       A  a       ta A  A       Gc        at GC        Ta        at AT        Gt        at                         ttttatttcacaatttaattataaatataaatattgcataaaaatcgttaataaaaacatctatttgataataaaatattaaaaaaatattatttttttatgataaaataatatcaagtaaaacctacataatatataacatgttaaagggggtaaagatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [TQ] COG2508 Regulator of polyketide synthase expression ... can be seen here     ..................................................................................................................