                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:156 nt.    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-13.20 kcal/mol
Antiterminator:    Distance from promoter:96 nt. Size=64 nt.     Delta G=-14.10 kcal/mol
Anti-antiterminator:    Distance from promoter:48 nt.    Size=62 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTTCA-TAAAAT. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTTCAAATCACCCAAAAGCTAATAAAATCGAAATTCCAGAATGGTTAGTGACTGGTG
AAAATATAGTGTGTTATTAGgttttgttagtgggctattttagaagcagaggctttgataattaaatatgtactagaaattaaga
gatattgtttttagtataatatctctttaatattatttttttacgtcacggttttcactgtgacgttttttatatctatcaaaaatggaaggaggatttt
atATG

    CAC1438 --- CAC1439 --- CAC1440 --- CAC1441 Gene: CAC1438     GI: 15894717     BI number: CAC1438     GOG: -------     Description: Hypothetical protein Gene: CAC1439     GI: 15894718     BI number: CAC1439     GOG: NOG06430     Description: Uncharacterized conserved protein Gene: CAC1440     GI: 15894719     BI number: CAC1440     GOG: -------     Description: Hypothetical protein Gene: CAC1441     GI: 15894720     BI number: CAC1441     GOG: -------     Description: Hypothetical protei             t ga       t  a a  g      t  g cg       t  t gc        ta at        gt at        ta gt        ta |  g       at |  a       ta |  t       at |  a       gc |  a       at a  t       gc t  t       at ta        at ta       |  t ta       |  a at       |  a ta       |  t c  t      |  a g  g      |  t g  |      t  t gt        ta ta        at        tt gc        at       t  c at        at        ta ta        gt        gc t  |       at        gt g  |      t  t       cg tg       c  |       at ta        at        cg ta        ta        ta ta        gc        gc gt        tg        cg Gt        at        at                         tttttatatctatcaaaaatggaaggaggattttatATG     ..................................................................................................................