Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:147 nt.    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -7.30 kcal/mol
Antiterminator:    Distance from promoter:95 nt. Size=64 nt.     Delta G= -5.02 kcal/mol
Anti-antiterminator:    Distance from promoter:71 nt.    Size=27 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTAAA-TAAATT. It has a score value of 76.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTAAATTTGCCTATGAATATCTTAAATTAAATCCCAAAGATTATATTTGGTTTGAGG
ATGATTTTGCATTTGATTTTCAGGATATGGAAAGATTAAGTAAGTTACCATTCGATGA
AAATTGGTGCTATAAAAATCCGAAGAATTTACTATAAtatcagttataaaattttttaaaagagtaaggagtt
atataaatcttactcttttttgcgagttgtagaaattgcaaaacaaaaattagatgatttttctggaacattgagagatTTG

    CAC1442


Gene: CAC1442     GI: 15894721     BI number: CAC1442     GOG: -------     Description: Hypothetical protei


           tc
          a  a
           tg
           At
           At
           Ta
           At
           Ta
          C  |
          A  |
           Ta
           Ta
           Ta
           At
           At
           Gt
           At
           At
           Gt
          |  a
          |  a        t
 TG       |  a      a  a
A  A      C  a      t  t
G  A       Cg       t  a
C  A       Ta       g  a
T  A      A  g      a  a
T  T      A  t       gt
 AT       A  a       gc
 CG       A  a       at
 CG       A  g       at
 AT       T  g       ta
T  |      A  |       gc
 TG        Ta        at
 GC        Cg        gc
 AT        Gt        at
                        tttttgcgagttgtagaaattgcaaaacaaaaattagatgatttttctggaacattgagagatTTG


    ..................................................................................................................