                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:199 nt.    Distance to gene:14 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-17.40 kcal/mol
Antiterminator:    Distance from promoter:168 nt. Size=35 nt.     Delta G= -6.20 kcal/mol
Anti-antiterminator:    Distance from promoter:106 nt.    Size=70 nt.     Delta G=-19.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaat-tgtact. It has a score value of 73.63 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaatagctcaaggtttatttgtgtactcaaaaataatcaatattataatgagcatgttacatctttatttgcaaaatagcaaaaccgtgttctagaca
cggtttttttgggtctatttttgctacatttatagatatgatataatgctttaatttgcataatttagtcataagttatataaattaaagttctatattt
catgtttatatttaggttatatgattatgaggttgtaagtgaattcgttcatttacggccttttttatttaaggagattattATG

    CAC1446 --- CAC1447 --- tetP/tetQ Gene: CAC1446     GI: 15894725     BI number: CAC1446     GOG: -------     Description: Hypothetical protein Gene: CAC1447     GI: 15894726     BI number: CAC1447     GOG: COG0477     Description: MDR-type permease, probably tetracycline resistance protein Gene: tetP/tetQ     GI: 15894727     BI number: CAC1448     GOG: COG0480     Description: tetracycline resistance protein, tetQ family, GTPas tc g  a at ta ta tg at at ta at c  a gt ta ta ta at at ta ta         g ta       a  g       tc cg       t  t      t  g gt       t  t       at t  t       ta        at a  c       at        gc at        ta        ta ta        at        gt at        tg        at ta        ta        at |  t      t  t       ta |  t       gt        gc at        ta        tg gc        at        tg ta        cg        gc at        ta        gc tg        tg        at at        tg        gt                         ttttatttaaggagattattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here [J] COG0480 Translation elongation factors (GTPases) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_acetobutylicum                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:56 nt.    Distance to gene:173 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -9.00 kcal/mol Antiterminator:    Distance from promoter:22 nt. Size=43 nt.     Delta G= -7.32 kcal/mol Anti-antiterminator:   Size=42 nt.     Delta G= -3.70 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgaat-tgtact. It has a score value of 73.63 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgaatagctcaaggtttatttgtgtactcaaaaataatcaatattataatgagcatgttacatctttatttgcaaaatagcaaaaccgtgttctagaca cggtttttttgggtctatttttgctacatttatagatatgatataatgctttaatttgcataatttagtcataagttatataaattaaagttctatattt catgtttatatttaggttatatgattatgaggttgtaagtgaattcgttcatttacggccttttttatttaaggagattattATG     CAC1446 --- CAC1447 --- tetP/tetQ Gene: CAC1446     GI: 15894725     BI number: CAC1446     GOG: -------     Description: Hypothetical protein Gene: CAC1447     GI: 15894726     BI number: CAC1447     GOG: COG0477     Description: MDR-type permease, probably tetracycline resistance protein Gene: tetP/tetQ     GI: 15894727     BI number: CAC1448     GOG: COG0480     Description: tetracycline resistance protein, tetQ family, GTPas            aa           a  t aa       a  a c  t       cg ta        gc at        ta at        ta ta        ta at       a  a a  a      t  c a  a      t  | a  |      t  | at       c  | cg       t  | ta       a  | cg       c  | |  c      a  |        t |  a      t  |      c  a |  t      t  |       tg |  g       gc        ta |  t       tg        gc at        at        ta ta        cg        gc gc        gt        cg ta        at        cg gt        gc        at                         ttttttgggtctatttttgctacatttatagatatgatataatgctttaatttgcataatttagtcataagttatataaattaaagttctatatttcatgtttatatttaggttatatgattatgaggttgtaagtgaattcgttcatttacggccttttttatttaaggagattattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here [J] COG0480 Translation elongation factors (GTPases) ... can be seen here     ..................................................................................................................