                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:179 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=58 nt.     Delta G= -7.30 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGTATTTCAATTTGTGGATGATAATGAAATTTAGtaaagcatttaaacagatgatttctgaaattaaacttag
gaaaaaatctagtagttaaaaagaagctcgttttaaatgagcttcttttagtttggtctgtatttagagaaaaggagtatttatggctttatgcttaata
aaattatttcaataataaaatatgaccctttctaagtattgtaatgtaagaactaaagtattaaaatatagttaactgggttatacattaaccaggttaa
ttaaaatattattgaggggtgattttATG

    CAC1464 --- CAC1465 Gene: CAC1464     GI: 15894743     BI number: CAC1464     GOG: COG0178     Description: UVRA-like protein, probably involved in MDR transport Gene: CAC1465     GI: 15894744     BI number: CAC1465     GOG: COG1846     Description: Transcriptional regulator, MarR/EmrR famil            aa           a  a           a  a            gt            gc            at            ta            tg           |  t           c  a           a  g            at            at            ta aa        ta a  c      a  a ta       a  a tg       a  | ta       g  | at        ta cg        cg g  a       ta         t at        ta       t  a at        tg        ta at       |  c       ta t  |       at        gt Gc        gc        cg At        tg        ta Tg        at        cg Ta        gt        gc Ta        at        at                         tcttttagtttggtctgtatttagagaaaaggagtatttatggctttatgcttaataaaattatttcaataataaaatatgaccctttctaagtattgtaatgtaagaactaaagtattaaaatatagttaactgggttatacattaaccaggttaattaaaatattattgaggggtgattttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0178 Excinuclease ATPase subunit ... can be seen here [K] COG1846 Transcriptional regulators ... can be seen here     ..................................................................................................................