                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:73 nt.    Distance to gene:145 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-12.90 kcal/mol
Antiterminator:    Distance from promoter:42 nt. Size=41 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:    Distance from promoter:8 nt.    Size=44 nt.     Delta G= -3.61 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-tgttat. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaattctgttcatataaagttgttatatatggctataggcaaaatcaatcctattataataattaccaggttgcgtatttttaaactattaataaaa
aaatgctgtactagtaaatttttaaattattagtactgcattttttatatatacttttttagaacaataagagaagaaaagtttaaagttaaaacttttt
aagaaatagttttatttagaggtcctttgtaatataaattcatattaagtacacaatatattgtaggagaagaaatgaagaggagattgttTTG

    CAC1473 --- CAC1474 --- CAC1475 --- CAC1476 Gene: CAC1473     GI: 15894752     BI number: CAC1473     GOG: COG1174     Description: Proline/glycine betaine ABC-type transport system, permease component Gene: CAC1474     GI: 15894753     BI number: CAC1474     GOG: COG1732     Description: Proline/glycine betaine ABC transport system, periplasmic component Gene: CAC1475     GI: 15894754     BI number: CAC1475     GOG: COG1125     Description: Proline/glycine betaine ABC transport system, ATPase component Gene: CAC1476     GI: 15894755     BI number: CAC1476     GOG: COG1174     Description: Proline/glycine betaine ABC-type transport system, permease componen   t a  a a  a t  t at         a ta       t  t t  c      c  t        t a  c      a  a      t  t ta       a  a      t  a cg        at       t  a cg        ta       a  a t  |       ta        at a  |       ta        at a  |       ta        ta c  |       ta        gt t  |      a  a       at a  |       ta        ta a  |       gt        cg at        cg        at at        gc        ta cg       |  t       gc gc       |  g      t  t g  g      t  t       cg at        ta        gc ta        gc        ta at        gt        at                         tttttatatatacttttttagaacaataagagaagaaaagtttaaagttaaaactttttaagaaatagttttatttagaggtcctttgtaatataaattcatattaagtacacaatatattgtaggagaagaaatgaagaggagattgttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1174 ABC-type proline/glycine betaine transport systems, permease component ... can be seen here [M] COG1732 Periplasmic glycine betaine/choline-binding (lipo)protein of an ABC-type transport system (osmoprotectant binding protein) ... can be seen here [E] COG1125 ABC-type proline/glycine betaine transport systems, ATPase components ... can be seen here [E] COG1174 ABC-type proline/glycine betaine transport systems, permease component ... can be seen here     ..................................................................................................................