                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-15.70 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAATAGAGGAAGATACCATAGAAAGACGATATTATAAATCACTAGAAAATTTAAAGAA
AGTGTTCCATTTATGTAATGAAATAAACATATATGATAATACAGATAAATTTAAACAT
ATAGCGTATGTATGCGATGGTGTAATTATATGGAAAAGAAGTTTCATTCCAGAGTGGA
GTAGAGATATTTTAAAATAAagctggcttgatattagtttattaggctggcttttgttgtatatcaataaatattaatacacaaa
atataattgctagagactatattataagggaggagtaaaaaTTG

    CAC1492 Gene: CAC1492     GI: 15894771     BI number: CAC1492     GOG: COG1741     Description: Uncharacterized protein, YhhW/pirin famil            AG           G  A            AT            TA            GT            AT        ag            GT       t  t            GT       t  t   A        TA        at G  G      |  A       ta A  T      |  A       at CG       |  A       gt CG       |  T       ta TA       |  A       tg TG       |  A       cg AT       G  a       gc |  A      A  g      g  t CG        Gc       t  g TA        At        cg TG        Cg        gc TA        Cg        at                         tttgttgtatatcaataaatattaatacacaaaatataattgctagagactatattataagggaggagtaaaaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1741 Pirin-related protein ... can be seen here     ..................................................................................................................