                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=60 nt.     Delta G= -8.29 kcal/mol
Anti-antiterminator:   Size=76 nt.     Delta G=-13.41 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGTTAAAAGTTATGGGCCATTTGTTATGAATACAGAAGAAGAAATTGAAGAAGCTTT
TTCTGATTACAGGGAAACTGGTTTTGGAGGATGGCAGTGGCAAAGAGATGATGTAGTT
CATCAAAGAAATAAAGGCAGATTTGCTGAGTATCCTGACGGTACAGTTGAATATAGAT
AAgaataggaaagggcaagtttgctcttttttattttggctatgttttaaatcagtgttgaaaatagatatatattagaaaaataggttataatattag
atagaatagtgtttaggaggtagaattATG

    CAC1493 --- CAC1494 Gene: CAC1493     GI: 15894772     BI number: CAC1493     GOG: COG3677     Description: Zn-finger DNA-binding domain Gene: CAC1494     GI: 15894773     BI number: CAC1494     GOG: COG3677     Description: Hypothetical protein, CF-32 famil TA G  G T  T AT GC TA AT GC |  A       TA |  A      G  C |  A      G  A |  G       CG |  A       AT |  A       GT |  A      |  G |  T      |  A |  A      |  A |  A      |  T |  A      |  A |  G      |  T |  G      |  A |  C      |  G |  A      |  A A  G      |  T G  A      |  A AT       |  A AT       |  g AT       |  a CG       |  a GC       |  t GT        Ta TG        Cg G  A       Cg A  G       Ta C  |      A  a G  |      T  a       gt GT       G  g      a  t TA       A  |       at AT       G  |       cg GC        Tg        gc GC        Cg        gt AT        Gc        gc |  G       Ta        at G  A       Ta        at GC        Tg        at TG        At        gt TG        Gt        gt                         tattttggctatgttttaaatcagtgttgaaaatagatatatattagaaaaataggttataatattagatagaatagtgtttaggaggtagaattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG3677 Transposase and inactivated derivatives ... can be seen here [L] COG3677 Transposase and inactivated derivatives ... can be seen here     ..................................................................................................................