                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:42 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -3.41 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tagggaaattggtgaaaatccaatgcaacccccgttactgtatacagttacaaaaccaatgtccactggagttttctctgggaaggatggttgaggctaa
actgtgagccaggagacctacctaaaatattatggaacttcggagggaagtgaaatccataaacataatcatgctattcaaacaattacaagcttgaatg
gttatttttatatttatgcattaatttcattctccgcaaaagcggagttttttcttttatataattattattagattaatacttttaagggagatttttt
ATG

    CAC2441 --- CAC2442 --- CAC2443 --- CAC2444 Gene: CAC2441     GI: 15895706     BI number: CAC2441     GOG: COG0614     Description: Ferrichrome-binding periplasmic protein Gene: CAC2442     GI: 15895707     BI number: CAC2442     GOG: COG0609     Description: Hemin permease Gene: CAC2443     GI: 15895708     BI number: CAC2443     GOG: COG1120     Description: Iron (III) ABC transporter, ATPase component Gene: CAC2444     GI: 15895709     BI number: CAC2444     GOG: COG2158     Description: Predicted metal-binding protei             t           t  t           a  a           t  t           a  g           t  c           t  a           t  t           t  t ta       t  a t  c      a  a a  a      t  t a  a      t  t c  g       gt a  c       gc at        ta at        at        aa cg        at       a  a ta        gc        cg ta       |  t       gc at       t  c       cg tg       t  c       cg cg        cg        ta gt        gc        cg                         ttttttcttttatataattattattagattaatacttttaagggagattttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here [P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here [PH] COG1120 ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components ... can be seen here [R] COG2158 Uncharacterized protein containing a Zn-finger-like domain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_acetobutylicum This operon is putativelly rgulated by Cobalamin_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:49 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -9.50 kcal/mol Antiterminator: Size=46 nt.     Delta G= -3.41 kcal/mol Anti-antiterminator:   Size=30 nt.     Delta G= -6.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tagggaaattggtgaaaatccaatgcaacccccgttactgtatacagttacaaaaccaatgtccactggagttttctctgggaaggatggttgaggctaa actgtgagccaggagacctacctaaaatattatggaacttcggagggaagtgaaatccataaacataatcatgctattcaaacaattacaagcttgaatg gttatttttatatttatgcattaatttcattctccgcaaaagcggagttttttcttttatataattattattagattaatacttttaagggagatttttt ATG     CAC2441 --- CAC2442 --- CAC2443 --- CAC2444 Gene: CAC2441     GI: 15895706     BI number: CAC2441     GOG: COG0614     Description: Ferrichrome-binding periplasmic protein Gene: CAC2442     GI: 15895707     BI number: CAC2442     GOG: COG0609     Description: Hemin permease Gene: CAC2443     GI: 15895708     BI number: CAC2443     GOG: COG1120     Description: Iron (III) ABC transporter, ATPase component Gene: CAC2444     GI: 15895709     BI number: CAC2444     GOG: COG2158     Description: Predicted metal-binding protei             t           t  t           a  a           t  t           a  g           t  c           t  a           t  t           t  t ta       t  a a  a      a  a c  a      t  t c  c      t  t t  a       gt a  t       gc aa        ta aa        at        aa gt        at       a  a tc        gc        cg ga       |  t       gc at       t  c       cg ag       t  c       cg gc        cg        ta gt        gc        cg                         ttttttcttttatataattattattagattaatacttttaagggagattttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here [P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here [PH] COG1120 ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components ... can be seen here [R] COG2158 Uncharacterized protein containing a Zn-finger-like domain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................