                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:151 nt.    Distance to gene:32 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-14.00 kcal/mol
Antiterminator:    Distance from promoter:114 nt. Size=48 nt.     Delta G= -5.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaac-tataat. It has a score value of 84.34 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaacttgttataattatgatatataatataaaaaaataaagaatgatcttcagggcagggtgaaattccctaccggcggtatagcccgcgagcctttt
taggtatgatccggtttgattccggagccgacagtaaagtctggatgaaagaagatatatagcattattttgatatgtatgccctgacgtttttcgttgg
ggcttttttaatgcttctgaagattttaggagggtttaagTTG

    CAC2841 Gene: CAC2841     GI: 15896096     BI number: CAC2841     GOG: COG3601     Description: Conserved membrane protein, probable transporter, YPAA B.subtilis ortholo at t  t t  t at cg g  a at ta at tg at ta at         t g  g      t  t a  c      t  t a  c       gc gc        cg at        at a  g      g  t a  a      t  g gc        cg tg        cg at        cg gt        gc             ttttttaatgcttctgaagattttaggagggtttaagTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3601 Predicted membrane protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................