                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:179 nt.    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-12.60 kcal/mol
Antiterminator:    Distance from promoter:143 nt. Size=47 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:    Distance from promoter:108 nt.    Size=52 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatg-tataat. It has a score value of 85.68 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatgcataggagtgtaaagtgatataattaaggaaaattaaatatattttagctaggggtgccttttaaggcttttatagttgatatcattaaaaata
tttaactaataaaagactttaggctgagaggagaaatccaaccctttgaacttgatgtagttaatactaccgtagggaagcagtgcattgtatattatag
aagtttagtaagcttgcccttttggcgagctttttttatttttatgatgcaactgaatcctaatataaaattaaaggagagtatattATG

    thiC_lrep_1 Gene: thiC_lrep_1     GI: 15896266     BI number: CAC0495     GOG: COG0422     Description: Thiamine biosynthesis protein Thi aa t  t ta         a gc       t  t at       t  a ta       a  g gc       t  a t  c      a  a a  g      t  g gt       g  t ta       t  t tg       t  t cg       a  a |  g       cg |  a       gt a  a       ta         t a  g      g  a      t  t gc       a  |      c  t ta        cg        cg tg        gc        cg t  t       at        gc c  g       at        tg c  c      |  g       ta c  a       gc        cg at        gc        gc at        gc        at cg        at        at                         tttttatttttatgatgcaactgaatcctaatataaaattaaaggagagtatattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0422 Thiamine biosynthesis protein ThiC ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_acetobutylicum This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:179 nt.    Distance to gene:51 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-12.60 kcal/mol Antiterminator:    Distance from promoter:142 nt. Size=47 nt.     Delta G= -8.50 kcal/mol Anti-antiterminator:    Distance from promoter:111 nt.    Size=36 nt.     Delta G= -6.70 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgatg-tataat. It has a score value of 85.68 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgatgcataggagtgtaaagtgatataattaaggaaaattaaatatattttagctaggggtgccttttaaggcttttatagttgatatcattaaaaata tttaactaataaaagactttaggctgagaggagaaatccaaccctttgaacttgatgtagttaatactaccgtagggaagcagtgcattgtatattatag aagtttagtaagcttgcccttttggcgagctttttttatttttatgatgcaactgaatcctaatataaaattaaaggagagtatattATG     thiC_lrep_1 Gene: thiC_lrep_1     GI: 15896266     BI number: CAC0495     GOG: COG0422     Description: Thiamine biosynthesis protein Thi             t           t  a           a  t aa       t  a t  t      a  g ta       t  a gc       g  a at       t  g ta       t  t gc       a  t t  |      c  t a  |       ga g  |       tg t  |       gt         t t  |      a  a      t  t c  |      c  |      c  t a  |       ga        cg a  |       ag        cg gc        ac        gc tg        gt        tg t  t      |  t       ta ta        gg        cg cg        gc        gc cg        ac        at cg        tc        at                         tttttatttttatgatgcaactgaatcctaatataaaattaaaggagagtatattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0422 Thiamine biosynthesis protein ThiC ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................