                                                                        Gene putatively regulated by attenuation in C_acetobutylicum_pl-pSOL1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:137 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-12.90 kcal/mol
Antiterminator: Size=26 nt.     Delta G= -3.20 kcal/mol
Anti-antiterminator:   Size=64 nt.     Delta G= -6.26 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATAATATAAAACTTATATCAAGTAATATTACACAATGGATGCAAATATATATGAATT
ATATATATTATAGTAATGATGATATCACATGGTATAAGATGGATCTTGATGGAAGCAA
CTTAACTAATTTACTAATTTAAaaagattggggaaacccaatctttttaatatttatatataattaattgtattggtatgtagg
acatttatataaatatgctttttcatgcatttttatataaagatagtgccataagaaaacgatataattaaaaaataaataagtttcatggaggacttaa
ATG

    CAP0003 Gene: CAP0003     GI: 15004708     BI number: CAP0003     GOG: COG5279,COG5492     Description: Transglutaminase-like predicted protease domain fused to ChW-repeats and cell-adhesion domai GA T  T TG CG TA A  A G  G GC TA A  A GC AT AT TA A  | TA GC GT TA A  A C  T A  | C  | T  | A  | T  |       Aa A  |      A  a G  |       Ta T  |       Tg A  |       Ta        aa G  |       At       g  a T  |       At        gc AT        Tg        gc AT        Cg        gc TA       A  g       ta GC       T  g       ta AT        Ta        at TA        Ta        gc                         tttttaatatttatatataattaattgtattggtatgtaggacatttatataaatatgctttttcatgcatttttatataaagatagtgccataagaaaacgatataattaaaaaataaataagtttcatggaggacttaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG5279 Uncharacterized protein involved in cytokinesis, contains TGc (transglutaminase/protease-like) domain ... can be seen here [N] COG5492 Bacterial surface proteins containing Ig-like domains ... can be seen here     ..................................................................................................................