                                                                        Gene putatively regulated by attenuation in C_acetobutylicum_pl-pSOL1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:99 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-17.60 kcal/mol
Antiterminator: Size=74 nt.     Delta G= -9.25 kcal/mol
Anti-antiterminator:   Size=79 nt.     Delta G=-12.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCCCTGTTCTATATCAAAATCCTAATGTAAAAGGTATAACTTTATGGGGATATATGC
AAGGTCAAACTTGGAATAGTGGTACTTATTTAGTTAATTCAAATGGTACTGAACGTCC
AGCTCTTAAATGGTTAAGATCTTACTTAGCATCACATTAGaatatttagctcctatttagtaaactccta
aataggagcttttttatataaataaataatcccttgacatattttataaaaagcgatattatttccatatagaattaatacgatatcgaaataatactaa
aaggaaatgattatATG

    CAP0052 --- CAP0051 Gene: CAP0052     GI: 15004756     BI number: CAP0052     GOG: COG1846     Description: MarR family HTH transcriptional regulator Gene: CAP0051     GI: 15004755     BI number: CAP0051     GOG: COG0300     Description: Oxidoreductas   A T  A T  T G  T A  C       CT TA       T  T TA       A  A TA        GC AT        AT T  |       AT TG        TA CG        TG AT        GC TA       |  A GC       |  T GT       G  C TG       T  A G  A      A  C A  A      A  A T  C      A  T A  G      T  T AT        TA GC        CG GC        Ta TA       |  a |  G      |  t |  C      |  a |  T      |  t |  C      |  t |  T      |  t        a |  T      |  a      a  c |  A       Cg       a  t |  A       Gc       t  c |  A       At        gc |  T      C  c       at TG       C  c       ta CG       T  t       ta AT       G  a       ta AT       C  |       at |  A       At        ta A  A       At        cg CG        Gt        cg TA        Ta        ta GT        Cg        cg GC        At        gc AT        Ta        at                         tttttatataaataaataatcccttgacatattttataaaaagcgatattatttccatatagaattaatacgatatcgaaataatactaaaaggaaatgattatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1846 Transcriptional regulators ... can be seen here [R] COG0300 Short-chain dehydrogenases of various substrate specificities ... can be seen here     ..................................................................................................................