                                                                        Gene putatively regulated by attenuation in C_acetobutylicum_pl-pSOL1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:166 nt.    Distance to gene:60 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-12.60 kcal/mol
Antiterminator:    Distance from promoter:130 nt. Size=49 nt.     Delta G= -3.40 kcal/mol
Anti-antiterminator:    Distance from promoter:126 nt.    Size=31 nt.     Delta G= -4.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGGG-TATGAT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGGGGAAGATGGAAGGCTGTCGTTTATGATCCATCTGGTAATGTTTATGCAACAGC
ATATTTTAGTACAGATTCTGCAGCAAGAGATTGGGTAGACGAAAACTATCCAAATTGT
GTAGCTAACGTATATGAAGTTTAAaagtaagattataatacataacaatttaatattgctattttaattgttatgaattgag
agctgatttcattttggaatcagcttttcttacaaaaagttcaataaaataagctattaattattatgaaaaataaaaaaggtgaggctATG

    CAP0073 --- CAP0074 Gene: CAP0073     GI: 15004777     BI number: CAP0073     GOG: COG2274     Description: ABC ATPase containing transporter Gene: CAP0074     GI: 15004778     BI number: CAP0074     GOG: COG0845     Description: Hypothetical protei            ta           t  t           g  g            ta            ta            at            at            tg            ta           t  g tg       t  | t  c      a  | at        ta ta        cg         t at        gc       t  t at       t  t      a  t |  t      t  g       cg t  t      a  |       tg ta        ta        ta ta        at        ta at        at        at at       t  t       gc cg       t  c       ta at        ta        cg at        at        gc ta        at        at                         tttcttacaaaaagttcaataaaataagctattaattattatgaaaaataaaaaaggtgaggctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG2274 ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain ... can be seen here [M] COG0845 Membrane-fusion protein ... can be seen here     ..................................................................................................................