Gene putatively regulated by attenuation in C_acetobutylicum_pl-pSOL1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:46 nt.    Distance to gene:113 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-23.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATT-CATATT. It has a score value of 70.95 and is shown in blue

TTGATTTCAAAGAAGTTGAAAGTCATATTTCAAAAGAAGATATGGATGATGATTATAC
GGATTTTTAAtataaaaggggctgtggtactaatttttagtgctacagctccttttatatggttgttttaatagagttaaatattgttctatt
tatatagaatgtgataccataatggtaattgaagttacttgtttaaatgtatataaatttaaaagggagttttaaaATG

    CAP0124


Gene: CAP0124     GI: 15004827     BI number: CAP0124     GOG: COG0477     Description: Permease, MDR related, probably tetracycline resistance protei


           t
         t  t
          at
          at
          ta
          cg
          at
          tg
          gc
          gt
          ta
          gc
          ta
          cg
          gc
          gt
          gc
          gc
            ttttatatggttgttttaatagagttaaatattgttctatttatatagaatgtgataccataatggtaattgaagttacttgtttaaatgtatataaatttaaaagggagttttaaaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here

    ..................................................................................................................