                                                                        Gene putatively regulated by attenuation in C_acetobutylicum_pl-pSOL1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:143 nt.    Distance to gene:75 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-16.30 kcal/mol
Antiterminator:    Distance from promoter:88 nt. Size=63 nt.     Delta G= -5.02 kcal/mol
Anti-antiterminator:    Distance from promoter:61 nt.    Size=46 nt.     Delta G= -3.76 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: CTGCTA-TATATT. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGCTAGTCAAAGAGAGTTAAACTATATTGGAGTTAACTTAGACTCTATTAATGAAAT
TCAAATAATCAGCAATGGAAGTCTCTATAGCACCATATATGTAATCGACAAAAACAAT
ATATTATATATGATAAATGGAATATTTTTTAAATTACAAAAATAActtatttataaaaagagtaaac
ataggtgtatcctaattgtttactctttttttctatttacaatttatctattatgttatacaatatagttaaactaacttgcataacataatagcgaggt
gattttaTTG

    CAP0153 --- CAP0154 Gene: CAP0153     GI: 15004856     BI number: CAP0153     GOG: COG1695     Description: Predicted transcriptional regulator Gene: CAP0154     GI: 15004857     BI number: CAP0154     GOG: NOG19189     Description: Membrane protei            AT           A  T           A  A           T  C            TA            TA   A        TA A  A       TA A  C       TA A  A       AT C  A       TA A  T      A  A        t G  A      A  c      g  a C  T       Gt       t  t TA        Gt        gc AT        Ta        gc AT        At        at TA        At        ta GT        At       |  a TA        Ta       |  t AT        At        at TA       G  a       cg AT       T  a       at |  G      A  a       at |  A      T  a       at |  T      A  a       ta |  A      T  g       gc |  A      A  |       at TA        Ta        gc AT        Tg        at CG        At        at CG        Ta        at                         ttttctatttacaatttatctattatgttatacaatatagttaaactaacttgcataacataatagcgaggtgattttaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1695 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................