                                                                        Gene putatively regulated by attenuation in C_acetobutylicum_pl-pSOL1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:105 nt.    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-13.40 kcal/mol
Antiterminator:    Distance from promoter:54 nt. Size=64 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: CAGATT-TATAAT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGATTTTGTTAACAATGATCTTATAATAACTTGGACTAACAGACAATTCAGCCTAGA
AACCTCTGATGAGCTTGATATAACTTATACTCACTTTGAATTAGTATAAaatatttataattta
aattacttatatcagtggagataaccttcttcactgatattttaataacgaggtgtattATG

    CAP0159 Gene: CAP0159     GI: 15004862     BI number: CAP0159     GOG: -------     Description: Hypothetical protei   a a  t t  t at ta ta ta at t  t a  a a  c At At Ta At Ta G  | A  | T  | T  | A  | At Gc Ta        ac Tg       a  c T  t      t  t C  g       at A  |       gc Cg        at Ta        gt Cg        gc A  |       ta Ta        gc At        at Ta        cg Ta        ta             tattttaataacgaggtgtattATG     ..................................................................................................................