                                                                        Gene putatively regulated by attenuation in C_perfringens

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:153 nt.    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-17.00 kcal/mol
Antiterminator:    Distance from promoter:135 nt. Size=38 nt.     Delta G= -5.31 kcal/mol
Anti-antiterminator:    Distance from promoter:142 nt.    Size=10 nt.     Delta G= -3.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatc-tatatt. It has a score value of 72.96 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggcaacgcg is shown in italic-bold style

ttgatcaggctagtaatgttatatattgctttcagagagctagtggttttggtgtgaactagtacaatattttcatgaatccacctgtgagggactgtga
tgagcagtacggaattaaccgttaaagtttttaagaggataaaatctttttttgattttatcaattagggtggcaacgcggagtcttttcgtcccttttt
atagggaatggaggctccttttttatatatttttttagttaataaaattttaaatataaataaggttcttgaaaggagaATG

    CPE0009 Gene: serS     GI: 18308996     BI number: CPE0014     GOG: COG0172     Description: serine-tRNA ligas             c           t  t            gt            at            gt        tt            gc       t  a            cg       t  t            gt        ta           c  |       cg           a  |       cg           a  |       cg           c  |       ta           g  |      g  a           g  |      c  t           t  |      t  |            gc        tg            gc        tg            gc        ta ca        at        cg g  a      t  t       tg gc       t  t       gc tg        at        at gc        at        gc                         cttttttatatatttttttagttaataaaattttaaatataaataaggttcttgaaaggagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0172 Seryl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................