                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:116 nt.    Distance to gene:99 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -8.70 kcal/mol
Antiterminator:    Distance from promoter:95 nt. Size=24 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-taaaat. It has a score value of 86.35 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacatatattagttaaagagttaaaattattataaaattcaaataaGTCTCCATAGTTCAATGGATAGAACAATCC
CCTCCTAAGGGATAAATGTAGGTTCGATTCCTACTGGGGATAccatggttttaactgtgaaggaaaaac
tccatatttatatggagttttttaaatattattatttaatatgaaatttttgtataatataataattatataggaaaataaaaaaagaagaaaaatatat
agaataataggaggggtttatTTG

    Arg_v2 --- hlyA Gene: hlyA     GI: 18309012     BI number: CPE0030     GOG: COG1253     Description: probable hemolysin-related protein Gene: CPE0031     GI: 18309013     BI number: CPE0031     GOG: COG0590     Description: conserved hypothetical protei tg g  a ta        tt cg       t  a a  g       at a  a       ta ta        at ta        cg ta        cg ta        ta gc        cg gt        at             tttttaaatattattatttaatatgaaatttttgtataatataataattatataggaaaataaaaaaagaagaaaaatatatagaataataggaggggtttatTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1253 Hemolysins and related proteins containing CBS domains ... can be seen here [FJ] COG0590 Cytosine/adenosine deaminases ... can be seen here     ..................................................................................................................