                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:81 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-13.40 kcal/mol
Antiterminator: Size=64 nt.     Delta G= -8.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAGAAGGGGCAAAATTAATGATAGATCCTTCTTTCTGTAGAGTATGGTTTGGTACAA
GTTTAAATGTTATGTTAGTTAAAAAATATGGTGAAGAGGACTATAAAGAAGTTTTCAA
CTATATAAAAGATAACTACTTACAAAAAGAATGTAAAATAAGATCACTAAAGGTTTCA
TAAtatttttaatcagtaggtaaagctttacttactgatttttctttatgtgctataattaataaaaatttatgatgtttttatatgatttttatata
aaaaaattagtgtgaaagaagtgtttttATG

    CPE0032 Gene: CPE0033     GI: 18309015     BI number: CPE0033     GOG: NOG43182     Description: hypothetical protei TA C  A A  A CG TG AT GT AT A  C TA AT A  A A  | A  | TA Gt Ta At At Gt        gc At       a  t At        at |  a       at |  a       ta A  t       gc A  c       gt A  a       at Cg        ta At        gc Ta        at Tg        cg Cg        ta At        at Ta        at             tttctttatgtgctataattaataaaaatttatgatgtttttatatgatttttatataaaaaaattagtgtgaaagaagtgtttttATG     ..................................................................................................................