Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:56 nt.    Distance to gene:71 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-10.40 kcal/mol
Antiterminator:    Distance from promoter:20 nt. Size=43 nt.     Delta G= -5.90 kcal/mol
Anti-antiterminator:   Size=68 nt.     Delta G= -9.51 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATG-TATTTT. It has a score value of 72.29 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATGTAAAAGATATTATATGCTATTTTGTAGGAACTTTAATTTTAATATTTTGGGA
AGTTATTAATAAAGAGTAAtgatttttagtgagttcaagtttggggctcactttttttacataaataagaataggatagcatatta
tttatagagaatattatgtaatagtattaggaggatcctattGTG

    CPE0033


Gene: CPE0034     GI: 18309016     BI number: CPE0034     GOG: NOG42855     Description: hypothetical protei


 TT
A  T
T  T
 CG
 GT
 TA
|  G
A  G
T  A
A  A
T  C
T  T
A  T
T  T       AA
A  A      A  G
G  A      T  A
 AT       A  G
 AT        AT
 AT        TA
 AT        TA
|  A       At
 TA        Tg
 GT        Ta         t
 TA        Gt       g  t
 AT        At       a  t
 GT        At       a  g
T  T       Gt        cg
T  T       Gt        tg
 TG       |  a       tg
 CG       G  g       gc
 CG       T  t       at
 TA        Tg        gc
A  A       Ta        ta
 CG        Tg        gc
 AT        At        at
                        ttttttacataaataagaataggatagcatattatttatagagaatattatgtaatagtattaggaggatcctattGTG


    ..................................................................................................................